ID: 1135887488

View in Genome Browser
Species Human (GRCh38)
Location 16:26324310-26324332
Sequence TGTGGACCAGATTGAGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135887486_1135887488 3 Left 1135887486 16:26324284-26324306 CCTTTGATGACTTACTGGAAGCT No data
Right 1135887488 16:26324310-26324332 TGTGGACCAGATTGAGAGCCTGG No data
1135887484_1135887488 8 Left 1135887484 16:26324279-26324301 CCGTACCTTTGATGACTTACTGG No data
Right 1135887488 16:26324310-26324332 TGTGGACCAGATTGAGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135887488 Original CRISPR TGTGGACCAGATTGAGAGCC TGG Intergenic
No off target data available for this crispr