ID: 1135891417

View in Genome Browser
Species Human (GRCh38)
Location 16:26360689-26360711
Sequence GTGGCTGCAAACATATTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135891417_1135891421 13 Left 1135891417 16:26360689-26360711 CCTCCAAATATGTTTGCAGCCAC No data
Right 1135891421 16:26360725-26360747 TGCGTGCATTTGCATATTCATGG No data
1135891417_1135891422 27 Left 1135891417 16:26360689-26360711 CCTCCAAATATGTTTGCAGCCAC No data
Right 1135891422 16:26360739-26360761 TATTCATGGCTCCCAACCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135891417 Original CRISPR GTGGCTGCAAACATATTTGG AGG (reversed) Intergenic
No off target data available for this crispr