ID: 1135894440

View in Genome Browser
Species Human (GRCh38)
Location 16:26386138-26386160
Sequence CAGGGAAAGCAGAGTGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135894440_1135894442 -8 Left 1135894440 16:26386138-26386160 CCAGCCTCACTCTGCTTTCCCTG No data
Right 1135894442 16:26386153-26386175 TTTCCCTGAGAAAAGCAGCCAGG No data
1135894440_1135894447 11 Left 1135894440 16:26386138-26386160 CCAGCCTCACTCTGCTTTCCCTG No data
Right 1135894447 16:26386172-26386194 CAGGACTTGAATTAGAAGGATGG No data
1135894440_1135894445 7 Left 1135894440 16:26386138-26386160 CCAGCCTCACTCTGCTTTCCCTG No data
Right 1135894445 16:26386168-26386190 CAGCCAGGACTTGAATTAGAAGG No data
1135894440_1135894448 23 Left 1135894440 16:26386138-26386160 CCAGCCTCACTCTGCTTTCCCTG No data
Right 1135894448 16:26386184-26386206 TAGAAGGATGGTCCAAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135894440 Original CRISPR CAGGGAAAGCAGAGTGAGGC TGG (reversed) Intergenic
No off target data available for this crispr