ID: 1135900563

View in Genome Browser
Species Human (GRCh38)
Location 16:26455813-26455835
Sequence CTGAGCACACAGAACAAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135900562_1135900563 5 Left 1135900562 16:26455785-26455807 CCAACATCTTATGGAAAGGTGTA No data
Right 1135900563 16:26455813-26455835 CTGAGCACACAGAACAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135900563 Original CRISPR CTGAGCACACAGAACAAACA AGG Intergenic
No off target data available for this crispr