ID: 1135901540

View in Genome Browser
Species Human (GRCh38)
Location 16:26464650-26464672
Sequence TAGGTTTGAAAACCTGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135901540_1135901544 8 Left 1135901540 16:26464650-26464672 CCTGGGGCAGGTTTTCAAACCTA No data
Right 1135901544 16:26464681-26464703 TCCGCCTGGAAACAGACTGAGGG No data
1135901540_1135901541 -6 Left 1135901540 16:26464650-26464672 CCTGGGGCAGGTTTTCAAACCTA No data
Right 1135901541 16:26464667-26464689 AACCTATATTGCTCTCCGCCTGG No data
1135901540_1135901553 29 Left 1135901540 16:26464650-26464672 CCTGGGGCAGGTTTTCAAACCTA No data
Right 1135901553 16:26464702-26464724 GGCTATTGGGGTGGTAAGGTGGG No data
1135901540_1135901552 28 Left 1135901540 16:26464650-26464672 CCTGGGGCAGGTTTTCAAACCTA No data
Right 1135901552 16:26464701-26464723 GGGCTATTGGGGTGGTAAGGTGG No data
1135901540_1135901550 20 Left 1135901540 16:26464650-26464672 CCTGGGGCAGGTTTTCAAACCTA No data
Right 1135901550 16:26464693-26464715 CAGACTGAGGGCTATTGGGGTGG No data
1135901540_1135901548 16 Left 1135901540 16:26464650-26464672 CCTGGGGCAGGTTTTCAAACCTA No data
Right 1135901548 16:26464689-26464711 GAAACAGACTGAGGGCTATTGGG No data
1135901540_1135901547 15 Left 1135901540 16:26464650-26464672 CCTGGGGCAGGTTTTCAAACCTA No data
Right 1135901547 16:26464688-26464710 GGAAACAGACTGAGGGCTATTGG No data
1135901540_1135901551 25 Left 1135901540 16:26464650-26464672 CCTGGGGCAGGTTTTCAAACCTA No data
Right 1135901551 16:26464698-26464720 TGAGGGCTATTGGGGTGGTAAGG No data
1135901540_1135901549 17 Left 1135901540 16:26464650-26464672 CCTGGGGCAGGTTTTCAAACCTA No data
Right 1135901549 16:26464690-26464712 AAACAGACTGAGGGCTATTGGGG No data
1135901540_1135901543 7 Left 1135901540 16:26464650-26464672 CCTGGGGCAGGTTTTCAAACCTA No data
Right 1135901543 16:26464680-26464702 CTCCGCCTGGAAACAGACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135901540 Original CRISPR TAGGTTTGAAAACCTGCCCC AGG (reversed) Intergenic
No off target data available for this crispr