ID: 1135901613

View in Genome Browser
Species Human (GRCh38)
Location 16:26465020-26465042
Sequence AGAGAGGGACAGGTGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135901613_1135901622 20 Left 1135901613 16:26465020-26465042 CCACCCACCACCTGTCCCTCTCT No data
Right 1135901622 16:26465063-26465085 CTCTGGAAAGCGCCACCTCCTGG 0: 21
1: 145
2: 383
3: 436
4: 565
1135901613_1135901624 27 Left 1135901613 16:26465020-26465042 CCACCCACCACCTGTCCCTCTCT No data
Right 1135901624 16:26465070-26465092 AAGCGCCACCTCCTGGCAGGAGG 0: 35
1: 211
2: 454
3: 460
4: 522
1135901613_1135901621 3 Left 1135901613 16:26465020-26465042 CCACCCACCACCTGTCCCTCTCT No data
Right 1135901621 16:26465046-26465068 CTACTGCAGGTGATGCTCTCTGG No data
1135901613_1135901623 24 Left 1135901613 16:26465020-26465042 CCACCCACCACCTGTCCCTCTCT No data
Right 1135901623 16:26465067-26465089 GGAAAGCGCCACCTCCTGGCAGG 0: 32
1: 184
2: 384
3: 459
4: 486
1135901613_1135901618 -10 Left 1135901613 16:26465020-26465042 CCACCCACCACCTGTCCCTCTCT No data
Right 1135901618 16:26465033-26465055 GTCCCTCTCTATACTACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135901613 Original CRISPR AGAGAGGGACAGGTGGTGGG TGG (reversed) Intergenic
No off target data available for this crispr