ID: 1135901618

View in Genome Browser
Species Human (GRCh38)
Location 16:26465033-26465055
Sequence GTCCCTCTCTATACTACTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135901613_1135901618 -10 Left 1135901613 16:26465020-26465042 CCACCCACCACCTGTCCCTCTCT No data
Right 1135901618 16:26465033-26465055 GTCCCTCTCTATACTACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135901618 Original CRISPR GTCCCTCTCTATACTACTGC AGG Intergenic
No off target data available for this crispr