ID: 1135903778

View in Genome Browser
Species Human (GRCh38)
Location 16:26491486-26491508
Sequence GAGCCTACTCAGGGCAACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135903775_1135903778 -6 Left 1135903775 16:26491469-26491491 CCATTATATCACTCAGTGAGCCT No data
Right 1135903778 16:26491486-26491508 GAGCCTACTCAGGGCAACCATGG No data
1135903774_1135903778 3 Left 1135903774 16:26491460-26491482 CCTTTCACTCCATTATATCACTC No data
Right 1135903778 16:26491486-26491508 GAGCCTACTCAGGGCAACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135903778 Original CRISPR GAGCCTACTCAGGGCAACCA TGG Intergenic
No off target data available for this crispr