ID: 1135903901

View in Genome Browser
Species Human (GRCh38)
Location 16:26492781-26492803
Sequence CAGAACCCAACTCTATTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135903901_1135903903 -8 Left 1135903901 16:26492781-26492803 CCAAGCAATAGAGTTGGGTTCTG No data
Right 1135903903 16:26492796-26492818 GGGTTCTGGCTCAGATGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135903901 Original CRISPR CAGAACCCAACTCTATTGCT TGG (reversed) Intergenic
No off target data available for this crispr