ID: 1135905991

View in Genome Browser
Species Human (GRCh38)
Location 16:26512195-26512217
Sequence CTTGGCTGCACCCAGGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135905991_1135905997 15 Left 1135905991 16:26512195-26512217 CCAGCATCCTGGGTGCAGCCAAG No data
Right 1135905997 16:26512233-26512255 GGGCTAACAACAGCATCCAGTGG No data
1135905991_1135905995 -5 Left 1135905991 16:26512195-26512217 CCAGCATCCTGGGTGCAGCCAAG No data
Right 1135905995 16:26512213-26512235 CCAAGAAGTTGCCACTCAGAGGG No data
1135905991_1135905993 -6 Left 1135905991 16:26512195-26512217 CCAGCATCCTGGGTGCAGCCAAG No data
Right 1135905993 16:26512212-26512234 GCCAAGAAGTTGCCACTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135905991 Original CRISPR CTTGGCTGCACCCAGGATGC TGG (reversed) Intergenic
No off target data available for this crispr