ID: 1135913520

View in Genome Browser
Species Human (GRCh38)
Location 16:26582556-26582578
Sequence TCTTCCAACCATAAGATTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135913515_1135913520 -7 Left 1135913515 16:26582540-26582562 CCCCTCAAGACTCAGTTCTTCCA No data
Right 1135913520 16:26582556-26582578 TCTTCCAACCATAAGATTTGGGG No data
1135913517_1135913520 -9 Left 1135913517 16:26582542-26582564 CCTCAAGACTCAGTTCTTCCAAC No data
Right 1135913520 16:26582556-26582578 TCTTCCAACCATAAGATTTGGGG No data
1135913513_1135913520 13 Left 1135913513 16:26582520-26582542 CCATGCCGAGACATTATAGTCCC No data
Right 1135913520 16:26582556-26582578 TCTTCCAACCATAAGATTTGGGG No data
1135913512_1135913520 23 Left 1135913512 16:26582510-26582532 CCATCTAACTCCATGCCGAGACA No data
Right 1135913520 16:26582556-26582578 TCTTCCAACCATAAGATTTGGGG No data
1135913514_1135913520 8 Left 1135913514 16:26582525-26582547 CCGAGACATTATAGTCCCCTCAA No data
Right 1135913520 16:26582556-26582578 TCTTCCAACCATAAGATTTGGGG No data
1135913516_1135913520 -8 Left 1135913516 16:26582541-26582563 CCCTCAAGACTCAGTTCTTCCAA No data
Right 1135913520 16:26582556-26582578 TCTTCCAACCATAAGATTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135913520 Original CRISPR TCTTCCAACCATAAGATTTG GGG Intergenic
No off target data available for this crispr