ID: 1135913549

View in Genome Browser
Species Human (GRCh38)
Location 16:26582825-26582847
Sequence TTTCCCACACAGATGTAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135913543_1135913549 21 Left 1135913543 16:26582781-26582803 CCACCATTGCTCCAGAAAGGGTA No data
Right 1135913549 16:26582825-26582847 TTTCCCACACAGATGTAGGTAGG No data
1135913542_1135913549 22 Left 1135913542 16:26582780-26582802 CCCACCATTGCTCCAGAAAGGGT No data
Right 1135913549 16:26582825-26582847 TTTCCCACACAGATGTAGGTAGG No data
1135913544_1135913549 18 Left 1135913544 16:26582784-26582806 CCATTGCTCCAGAAAGGGTAATA No data
Right 1135913549 16:26582825-26582847 TTTCCCACACAGATGTAGGTAGG No data
1135913545_1135913549 10 Left 1135913545 16:26582792-26582814 CCAGAAAGGGTAATATATTGAGC No data
Right 1135913549 16:26582825-26582847 TTTCCCACACAGATGTAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135913549 Original CRISPR TTTCCCACACAGATGTAGGT AGG Intergenic
No off target data available for this crispr