ID: 1135914654

View in Genome Browser
Species Human (GRCh38)
Location 16:26594908-26594930
Sequence CTCCTGGATCTCTAAGTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135914650_1135914654 10 Left 1135914650 16:26594875-26594897 CCACTGCAGGCAACGGGCTGCTC No data
Right 1135914654 16:26594908-26594930 CTCCTGGATCTCTAAGTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135914654 Original CRISPR CTCCTGGATCTCTAAGTCTG GGG Intergenic
No off target data available for this crispr