ID: 1135923711

View in Genome Browser
Species Human (GRCh38)
Location 16:26673805-26673827
Sequence ATCTCATACTTGGAGTAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135923708_1135923711 6 Left 1135923708 16:26673776-26673798 CCAACACACTCTGGCAAGTCAAA No data
Right 1135923711 16:26673805-26673827 ATCTCATACTTGGAGTAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135923711 Original CRISPR ATCTCATACTTGGAGTAGGC TGG Intergenic
No off target data available for this crispr