ID: 1135926033

View in Genome Browser
Species Human (GRCh38)
Location 16:26694896-26694918
Sequence GCTCAGACCATGGCTTCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135926033_1135926046 26 Left 1135926033 16:26694896-26694918 CCCTCTGAAGCCATGGTCTGAGC No data
Right 1135926046 16:26694945-26694967 CCAGATCAGCTGGGATGCAATGG No data
1135926033_1135926043 17 Left 1135926033 16:26694896-26694918 CCCTCTGAAGCCATGGTCTGAGC No data
Right 1135926043 16:26694936-26694958 CAGCCATGGCCAGATCAGCTGGG No data
1135926033_1135926047 27 Left 1135926033 16:26694896-26694918 CCCTCTGAAGCCATGGTCTGAGC No data
Right 1135926047 16:26694946-26694968 CAGATCAGCTGGGATGCAATGGG No data
1135926033_1135926042 16 Left 1135926033 16:26694896-26694918 CCCTCTGAAGCCATGGTCTGAGC No data
Right 1135926042 16:26694935-26694957 TCAGCCATGGCCAGATCAGCTGG 0: 1
1: 2
2: 23
3: 250
4: 574
1135926033_1135926037 3 Left 1135926033 16:26694896-26694918 CCCTCTGAAGCCATGGTCTGAGC No data
Right 1135926037 16:26694922-26694944 ACCTTGGCCCCTTTCAGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135926033 Original CRISPR GCTCAGACCATGGCTTCAGA GGG (reversed) Intergenic