ID: 1135926035

View in Genome Browser
Species Human (GRCh38)
Location 16:26694906-26694928
Sequence CCAAGGTGCAGCTCAGACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135926035_1135926046 16 Left 1135926035 16:26694906-26694928 CCATGGTCTGAGCTGCACCTTGG No data
Right 1135926046 16:26694945-26694967 CCAGATCAGCTGGGATGCAATGG No data
1135926035_1135926047 17 Left 1135926035 16:26694906-26694928 CCATGGTCTGAGCTGCACCTTGG No data
Right 1135926047 16:26694946-26694968 CAGATCAGCTGGGATGCAATGGG No data
1135926035_1135926043 7 Left 1135926035 16:26694906-26694928 CCATGGTCTGAGCTGCACCTTGG No data
Right 1135926043 16:26694936-26694958 CAGCCATGGCCAGATCAGCTGGG No data
1135926035_1135926037 -7 Left 1135926035 16:26694906-26694928 CCATGGTCTGAGCTGCACCTTGG No data
Right 1135926037 16:26694922-26694944 ACCTTGGCCCCTTTCAGCCATGG No data
1135926035_1135926042 6 Left 1135926035 16:26694906-26694928 CCATGGTCTGAGCTGCACCTTGG No data
Right 1135926042 16:26694935-26694957 TCAGCCATGGCCAGATCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135926035 Original CRISPR CCAAGGTGCAGCTCAGACCA TGG (reversed) Intergenic