ID: 1135926042

View in Genome Browser
Species Human (GRCh38)
Location 16:26694935-26694957
Sequence TCAGCCATGGCCAGATCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135926033_1135926042 16 Left 1135926033 16:26694896-26694918 CCCTCTGAAGCCATGGTCTGAGC No data
Right 1135926042 16:26694935-26694957 TCAGCCATGGCCAGATCAGCTGG No data
1135926034_1135926042 15 Left 1135926034 16:26694897-26694919 CCTCTGAAGCCATGGTCTGAGCT No data
Right 1135926042 16:26694935-26694957 TCAGCCATGGCCAGATCAGCTGG No data
1135926035_1135926042 6 Left 1135926035 16:26694906-26694928 CCATGGTCTGAGCTGCACCTTGG No data
Right 1135926042 16:26694935-26694957 TCAGCCATGGCCAGATCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135926042 Original CRISPR TCAGCCATGGCCAGATCAGC TGG Intergenic