ID: 1135926402

View in Genome Browser
Species Human (GRCh38)
Location 16:26697683-26697705
Sequence AAGTGAAGAAACTCTCCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135926396_1135926402 18 Left 1135926396 16:26697642-26697664 CCAGAAACTATCCATTAGAGCTG No data
Right 1135926402 16:26697683-26697705 AAGTGAAGAAACTCTCCCAGTGG No data
1135926399_1135926402 -8 Left 1135926399 16:26697668-26697690 CCTCCAAAGCCAGAGAAGTGAAG No data
Right 1135926402 16:26697683-26697705 AAGTGAAGAAACTCTCCCAGTGG No data
1135926398_1135926402 7 Left 1135926398 16:26697653-26697675 CCATTAGAGCTGGAACCTCCAAA No data
Right 1135926402 16:26697683-26697705 AAGTGAAGAAACTCTCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135926402 Original CRISPR AAGTGAAGAAACTCTCCCAG TGG Intergenic
No off target data available for this crispr