ID: 1135927007

View in Genome Browser
Species Human (GRCh38)
Location 16:26704031-26704053
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135927003_1135927007 19 Left 1135927003 16:26703989-26704011 CCTGTATTGAAAATGACGTAAAC No data
Right 1135927007 16:26704031-26704053 TCTTACCTTAAGAAGCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135927007 Original CRISPR TCTTACCTTAAGAAGCTGGA AGG Intergenic
No off target data available for this crispr