ID: 1135928880

View in Genome Browser
Species Human (GRCh38)
Location 16:26719625-26719647
Sequence CTGCCTACACGTTTGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135928880_1135928887 22 Left 1135928880 16:26719625-26719647 CCTGGCTCCAAACGTGTAGGCAG No data
Right 1135928887 16:26719670-26719692 GAAGCAGGAAAAGCCTTTCCAGG No data
1135928880_1135928885 7 Left 1135928880 16:26719625-26719647 CCTGGCTCCAAACGTGTAGGCAG No data
Right 1135928885 16:26719655-26719677 ACGAACAATCCTCAGGAAGCAGG No data
1135928880_1135928889 26 Left 1135928880 16:26719625-26719647 CCTGGCTCCAAACGTGTAGGCAG No data
Right 1135928889 16:26719674-26719696 CAGGAAAAGCCTTTCCAGGGTGG No data
1135928880_1135928890 27 Left 1135928880 16:26719625-26719647 CCTGGCTCCAAACGTGTAGGCAG No data
Right 1135928890 16:26719675-26719697 AGGAAAAGCCTTTCCAGGGTGGG No data
1135928880_1135928884 0 Left 1135928880 16:26719625-26719647 CCTGGCTCCAAACGTGTAGGCAG No data
Right 1135928884 16:26719648-26719670 GGAAACAACGAACAATCCTCAGG No data
1135928880_1135928888 23 Left 1135928880 16:26719625-26719647 CCTGGCTCCAAACGTGTAGGCAG No data
Right 1135928888 16:26719671-26719693 AAGCAGGAAAAGCCTTTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135928880 Original CRISPR CTGCCTACACGTTTGGAGCC AGG (reversed) Intergenic
No off target data available for this crispr