ID: 1135930005

View in Genome Browser
Species Human (GRCh38)
Location 16:26728220-26728242
Sequence GAGACCAGGCTGTCTCTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135930005_1135930009 -4 Left 1135930005 16:26728220-26728242 CCAGTGAGAGACAGCCTGGTCTC No data
Right 1135930009 16:26728239-26728261 TCTCTAGAGAAGGCTGGTGATGG No data
1135930005_1135930007 -10 Left 1135930005 16:26728220-26728242 CCAGTGAGAGACAGCCTGGTCTC No data
Right 1135930007 16:26728233-26728255 GCCTGGTCTCTAGAGAAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135930005 Original CRISPR GAGACCAGGCTGTCTCTCAC TGG (reversed) Intergenic
No off target data available for this crispr