ID: 1135930309

View in Genome Browser
Species Human (GRCh38)
Location 16:26730688-26730710
Sequence CAGCTTTTCCTGGGGGAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135930309_1135930317 12 Left 1135930309 16:26730688-26730710 CCATATTCCCCCAGGAAAAGCTG No data
Right 1135930317 16:26730723-26730745 TCTTCTCAGAAGTCAGAGAATGG No data
1135930309_1135930318 13 Left 1135930309 16:26730688-26730710 CCATATTCCCCCAGGAAAAGCTG No data
Right 1135930318 16:26730724-26730746 CTTCTCAGAAGTCAGAGAATGGG No data
1135930309_1135930319 14 Left 1135930309 16:26730688-26730710 CCATATTCCCCCAGGAAAAGCTG No data
Right 1135930319 16:26730725-26730747 TTCTCAGAAGTCAGAGAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135930309 Original CRISPR CAGCTTTTCCTGGGGGAATA TGG (reversed) Intergenic
No off target data available for this crispr