ID: 1135930862

View in Genome Browser
Species Human (GRCh38)
Location 16:26735430-26735452
Sequence CAGATGAGTCCCAAATAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135930862_1135930863 10 Left 1135930862 16:26735430-26735452 CCTAGCTATTTGGGACTCATCTG No data
Right 1135930863 16:26735463-26735485 AGACAAAAATCCTTGTCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135930862 Original CRISPR CAGATGAGTCCCAAATAGCT AGG (reversed) Intergenic
No off target data available for this crispr