ID: 1135931019

View in Genome Browser
Species Human (GRCh38)
Location 16:26736768-26736790
Sequence CTACTATTCACTTGGAATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135931019_1135931023 22 Left 1135931019 16:26736768-26736790 CCAACATTCCAAGTGAATAGTAG No data
Right 1135931023 16:26736813-26736835 TGAATCTAAGTTCAGGAGACAGG No data
1135931019_1135931022 15 Left 1135931019 16:26736768-26736790 CCAACATTCCAAGTGAATAGTAG No data
Right 1135931022 16:26736806-26736828 AGATATATGAATCTAAGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135931019 Original CRISPR CTACTATTCACTTGGAATGT TGG (reversed) Intergenic
No off target data available for this crispr