ID: 1135931676

View in Genome Browser
Species Human (GRCh38)
Location 16:26743386-26743408
Sequence GAGGACAAACACTACCATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135931676_1135931685 28 Left 1135931676 16:26743386-26743408 CCCACATGGTAGTGTTTGTCCTC No data
Right 1135931685 16:26743437-26743459 AATTCTGTGTGTGAAGATCAGGG No data
1135931676_1135931684 27 Left 1135931676 16:26743386-26743408 CCCACATGGTAGTGTTTGTCCTC No data
Right 1135931684 16:26743436-26743458 TAATTCTGTGTGTGAAGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135931676 Original CRISPR GAGGACAAACACTACCATGT GGG (reversed) Intergenic
No off target data available for this crispr