ID: 1135931717

View in Genome Browser
Species Human (GRCh38)
Location 16:26743612-26743634
Sequence TGATTCTGGAGTGCAGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135931717_1135931719 -6 Left 1135931717 16:26743612-26743634 CCAGCAGCTGCACTCCAGAATCA No data
Right 1135931719 16:26743629-26743651 GAATCATTTTAATTCAGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135931717 Original CRISPR TGATTCTGGAGTGCAGCTGC TGG (reversed) Intergenic
No off target data available for this crispr