ID: 1135933360

View in Genome Browser
Species Human (GRCh38)
Location 16:26758187-26758209
Sequence CTGTGAACAAAGAGATGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135933355_1135933360 8 Left 1135933355 16:26758156-26758178 CCCAGATTTTTTCTTAACAATCC No data
Right 1135933360 16:26758187-26758209 CTGTGAACAAAGAGATGCCAAGG No data
1135933356_1135933360 7 Left 1135933356 16:26758157-26758179 CCAGATTTTTTCTTAACAATCCA No data
Right 1135933360 16:26758187-26758209 CTGTGAACAAAGAGATGCCAAGG No data
1135933354_1135933360 22 Left 1135933354 16:26758142-26758164 CCAGGGACAAACAGCCCAGATTT No data
Right 1135933360 16:26758187-26758209 CTGTGAACAAAGAGATGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135933360 Original CRISPR CTGTGAACAAAGAGATGCCA AGG Intergenic
No off target data available for this crispr