ID: 1135933559

View in Genome Browser
Species Human (GRCh38)
Location 16:26760022-26760044
Sequence AAATTGTGTTCTCCTTCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135933559_1135933565 23 Left 1135933559 16:26760022-26760044 CCTGAAGAAGGAGAACACAATTT No data
Right 1135933565 16:26760068-26760090 AATGAGATCAAATCCAATTCAGG No data
1135933559_1135933566 24 Left 1135933559 16:26760022-26760044 CCTGAAGAAGGAGAACACAATTT No data
Right 1135933566 16:26760069-26760091 ATGAGATCAAATCCAATTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135933559 Original CRISPR AAATTGTGTTCTCCTTCTTC AGG (reversed) Intergenic
No off target data available for this crispr