ID: 1135933560

View in Genome Browser
Species Human (GRCh38)
Location 16:26760047-26760069
Sequence TTGGCATGAGGTGGAAGGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135933560_1135933566 -1 Left 1135933560 16:26760047-26760069 CCGCACCTTCCACCTCATGCCAA No data
Right 1135933566 16:26760069-26760091 ATGAGATCAAATCCAATTCAGGG No data
1135933560_1135933565 -2 Left 1135933560 16:26760047-26760069 CCGCACCTTCCACCTCATGCCAA No data
Right 1135933565 16:26760068-26760090 AATGAGATCAAATCCAATTCAGG No data
1135933560_1135933569 13 Left 1135933560 16:26760047-26760069 CCGCACCTTCCACCTCATGCCAA No data
Right 1135933569 16:26760083-26760105 AATTCAGGGACTGTGCAAAAGGG No data
1135933560_1135933568 12 Left 1135933560 16:26760047-26760069 CCGCACCTTCCACCTCATGCCAA No data
Right 1135933568 16:26760082-26760104 CAATTCAGGGACTGTGCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135933560 Original CRISPR TTGGCATGAGGTGGAAGGTG CGG (reversed) Intergenic
No off target data available for this crispr