ID: 1135933561

View in Genome Browser
Species Human (GRCh38)
Location 16:26760052-26760074
Sequence TCTCATTGGCATGAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135933561_1135933568 7 Left 1135933561 16:26760052-26760074 CCTTCCACCTCATGCCAATGAGA No data
Right 1135933568 16:26760082-26760104 CAATTCAGGGACTGTGCAAAAGG No data
1135933561_1135933566 -6 Left 1135933561 16:26760052-26760074 CCTTCCACCTCATGCCAATGAGA No data
Right 1135933566 16:26760069-26760091 ATGAGATCAAATCCAATTCAGGG No data
1135933561_1135933565 -7 Left 1135933561 16:26760052-26760074 CCTTCCACCTCATGCCAATGAGA No data
Right 1135933565 16:26760068-26760090 AATGAGATCAAATCCAATTCAGG No data
1135933561_1135933569 8 Left 1135933561 16:26760052-26760074 CCTTCCACCTCATGCCAATGAGA No data
Right 1135933569 16:26760083-26760105 AATTCAGGGACTGTGCAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135933561 Original CRISPR TCTCATTGGCATGAGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr