ID: 1135933566

View in Genome Browser
Species Human (GRCh38)
Location 16:26760069-26760091
Sequence ATGAGATCAAATCCAATTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135933559_1135933566 24 Left 1135933559 16:26760022-26760044 CCTGAAGAAGGAGAACACAATTT No data
Right 1135933566 16:26760069-26760091 ATGAGATCAAATCCAATTCAGGG No data
1135933561_1135933566 -6 Left 1135933561 16:26760052-26760074 CCTTCCACCTCATGCCAATGAGA No data
Right 1135933566 16:26760069-26760091 ATGAGATCAAATCCAATTCAGGG No data
1135933560_1135933566 -1 Left 1135933560 16:26760047-26760069 CCGCACCTTCCACCTCATGCCAA No data
Right 1135933566 16:26760069-26760091 ATGAGATCAAATCCAATTCAGGG No data
1135933562_1135933566 -10 Left 1135933562 16:26760056-26760078 CCACCTCATGCCAATGAGATCAA No data
Right 1135933566 16:26760069-26760091 ATGAGATCAAATCCAATTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135933566 Original CRISPR ATGAGATCAAATCCAATTCA GGG Intergenic
No off target data available for this crispr