ID: 1135933569

View in Genome Browser
Species Human (GRCh38)
Location 16:26760083-26760105
Sequence AATTCAGGGACTGTGCAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135933561_1135933569 8 Left 1135933561 16:26760052-26760074 CCTTCCACCTCATGCCAATGAGA No data
Right 1135933569 16:26760083-26760105 AATTCAGGGACTGTGCAAAAGGG No data
1135933562_1135933569 4 Left 1135933562 16:26760056-26760078 CCACCTCATGCCAATGAGATCAA No data
Right 1135933569 16:26760083-26760105 AATTCAGGGACTGTGCAAAAGGG No data
1135933560_1135933569 13 Left 1135933560 16:26760047-26760069 CCGCACCTTCCACCTCATGCCAA No data
Right 1135933569 16:26760083-26760105 AATTCAGGGACTGTGCAAAAGGG No data
1135933563_1135933569 1 Left 1135933563 16:26760059-26760081 CCTCATGCCAATGAGATCAAATC No data
Right 1135933569 16:26760083-26760105 AATTCAGGGACTGTGCAAAAGGG No data
1135933564_1135933569 -6 Left 1135933564 16:26760066-26760088 CCAATGAGATCAAATCCAATTCA No data
Right 1135933569 16:26760083-26760105 AATTCAGGGACTGTGCAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135933569 Original CRISPR AATTCAGGGACTGTGCAAAA GGG Intergenic
No off target data available for this crispr