ID: 1135934963

View in Genome Browser
Species Human (GRCh38)
Location 16:26771757-26771779
Sequence CAGAGCAAGGAGCAGGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135934963_1135934969 -4 Left 1135934963 16:26771757-26771779 CCTCCATCCTGCTCCTTGCTCTG No data
Right 1135934969 16:26771776-26771798 TCTGCTTGGAAGGCCTTCCCAGG No data
1135934963_1135934971 9 Left 1135934963 16:26771757-26771779 CCTCCATCCTGCTCCTTGCTCTG No data
Right 1135934971 16:26771789-26771811 CCTTCCCAGGCTCCTCAAAATGG No data
1135934963_1135934972 10 Left 1135934963 16:26771757-26771779 CCTCCATCCTGCTCCTTGCTCTG No data
Right 1135934972 16:26771790-26771812 CTTCCCAGGCTCCTCAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135934963 Original CRISPR CAGAGCAAGGAGCAGGATGG AGG (reversed) Intergenic
No off target data available for this crispr