ID: 1135938829

View in Genome Browser
Species Human (GRCh38)
Location 16:26803434-26803456
Sequence CCCTTTGATGGCTGCATGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135938823_1135938829 3 Left 1135938823 16:26803408-26803430 CCCTAGTGTTGCAATCAAGATTT No data
Right 1135938829 16:26803434-26803456 CCCTTTGATGGCTGCATGCAGGG No data
1135938822_1135938829 22 Left 1135938822 16:26803389-26803411 CCTATCTTCATCACTCACACCCT No data
Right 1135938829 16:26803434-26803456 CCCTTTGATGGCTGCATGCAGGG No data
1135938824_1135938829 2 Left 1135938824 16:26803409-26803431 CCTAGTGTTGCAATCAAGATTTG No data
Right 1135938829 16:26803434-26803456 CCCTTTGATGGCTGCATGCAGGG No data
1135938821_1135938829 25 Left 1135938821 16:26803386-26803408 CCTCCTATCTTCATCACTCACAC No data
Right 1135938829 16:26803434-26803456 CCCTTTGATGGCTGCATGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135938829 Original CRISPR CCCTTTGATGGCTGCATGCA GGG Intergenic
No off target data available for this crispr