ID: 1135940005

View in Genome Browser
Species Human (GRCh38)
Location 16:26814441-26814463
Sequence CTGCAGAAATGCAATGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135940005_1135940008 1 Left 1135940005 16:26814441-26814463 CCATCTCCATTGCATTTCTGCAG No data
Right 1135940008 16:26814465-26814487 GCCAGCCCCAAGCGAGAAATGGG No data
1135940005_1135940010 2 Left 1135940005 16:26814441-26814463 CCATCTCCATTGCATTTCTGCAG No data
Right 1135940010 16:26814466-26814488 CCAGCCCCAAGCGAGAAATGGGG No data
1135940005_1135940007 0 Left 1135940005 16:26814441-26814463 CCATCTCCATTGCATTTCTGCAG No data
Right 1135940007 16:26814464-26814486 TGCCAGCCCCAAGCGAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135940005 Original CRISPR CTGCAGAAATGCAATGGAGA TGG (reversed) Intergenic
No off target data available for this crispr