ID: 1135940320

View in Genome Browser
Species Human (GRCh38)
Location 16:26816733-26816755
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135940320_1135940331 22 Left 1135940320 16:26816733-26816755 CCTCTCCCTCTGTCCATCCTGGG No data
Right 1135940331 16:26816778-26816800 CTCGAGTGACTACCTGCCCTGGG No data
1135940320_1135940330 21 Left 1135940320 16:26816733-26816755 CCTCTCCCTCTGTCCATCCTGGG No data
Right 1135940330 16:26816777-26816799 CCTCGAGTGACTACCTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135940320 Original CRISPR CCCAGGATGGACAGAGGGAG AGG (reversed) Intergenic
No off target data available for this crispr