ID: 1135940326

View in Genome Browser
Species Human (GRCh38)
Location 16:26816758-26816780
Sequence GAGGTTACGTCTGCAGGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135940326_1135940331 -3 Left 1135940326 16:26816758-26816780 CCCTGACCTGCAGACGTAACCTC No data
Right 1135940331 16:26816778-26816800 CTCGAGTGACTACCTGCCCTGGG No data
1135940326_1135940330 -4 Left 1135940326 16:26816758-26816780 CCCTGACCTGCAGACGTAACCTC No data
Right 1135940330 16:26816777-26816799 CCTCGAGTGACTACCTGCCCTGG No data
1135940326_1135940335 30 Left 1135940326 16:26816758-26816780 CCCTGACCTGCAGACGTAACCTC No data
Right 1135940335 16:26816811-26816833 TCAGTGCCTCCAGAGCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135940326 Original CRISPR GAGGTTACGTCTGCAGGTCA GGG (reversed) Intergenic
No off target data available for this crispr