ID: 1135940330

View in Genome Browser
Species Human (GRCh38)
Location 16:26816777-26816799
Sequence CCTCGAGTGACTACCTGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135940327_1135940330 -5 Left 1135940327 16:26816759-26816781 CCTGACCTGCAGACGTAACCTCG No data
Right 1135940330 16:26816777-26816799 CCTCGAGTGACTACCTGCCCTGG No data
1135940317_1135940330 23 Left 1135940317 16:26816731-26816753 CCCCTCTCCCTCTGTCCATCCTG No data
Right 1135940330 16:26816777-26816799 CCTCGAGTGACTACCTGCCCTGG No data
1135940324_1135940330 8 Left 1135940324 16:26816746-26816768 CCATCCTGGGTTCCCTGACCTGC No data
Right 1135940330 16:26816777-26816799 CCTCGAGTGACTACCTGCCCTGG No data
1135940318_1135940330 22 Left 1135940318 16:26816732-26816754 CCCTCTCCCTCTGTCCATCCTGG No data
Right 1135940330 16:26816777-26816799 CCTCGAGTGACTACCTGCCCTGG No data
1135940326_1135940330 -4 Left 1135940326 16:26816758-26816780 CCCTGACCTGCAGACGTAACCTC No data
Right 1135940330 16:26816777-26816799 CCTCGAGTGACTACCTGCCCTGG No data
1135940323_1135940330 15 Left 1135940323 16:26816739-26816761 CCTCTGTCCATCCTGGGTTCCCT No data
Right 1135940330 16:26816777-26816799 CCTCGAGTGACTACCTGCCCTGG No data
1135940325_1135940330 4 Left 1135940325 16:26816750-26816772 CCTGGGTTCCCTGACCTGCAGAC No data
Right 1135940330 16:26816777-26816799 CCTCGAGTGACTACCTGCCCTGG No data
1135940316_1135940330 28 Left 1135940316 16:26816726-26816748 CCTATCCCCTCTCCCTCTGTCCA No data
Right 1135940330 16:26816777-26816799 CCTCGAGTGACTACCTGCCCTGG No data
1135940328_1135940330 -10 Left 1135940328 16:26816764-26816786 CCTGCAGACGTAACCTCGAGTGA No data
Right 1135940330 16:26816777-26816799 CCTCGAGTGACTACCTGCCCTGG No data
1135940320_1135940330 21 Left 1135940320 16:26816733-26816755 CCTCTCCCTCTGTCCATCCTGGG No data
Right 1135940330 16:26816777-26816799 CCTCGAGTGACTACCTGCCCTGG No data
1135940322_1135940330 16 Left 1135940322 16:26816738-26816760 CCCTCTGTCCATCCTGGGTTCCC No data
Right 1135940330 16:26816777-26816799 CCTCGAGTGACTACCTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135940330 Original CRISPR CCTCGAGTGACTACCTGCCC TGG Intergenic
No off target data available for this crispr