ID: 1135940713

View in Genome Browser
Species Human (GRCh38)
Location 16:26819474-26819496
Sequence AGCCAAACCCCTAGTTTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135940713_1135940721 23 Left 1135940713 16:26819474-26819496 CCCAACAAACTAGGGGTTTGGCT No data
Right 1135940721 16:26819520-26819542 ATCGCCTCAAAATGTAAATTGGG No data
1135940713_1135940720 22 Left 1135940713 16:26819474-26819496 CCCAACAAACTAGGGGTTTGGCT No data
Right 1135940720 16:26819519-26819541 CATCGCCTCAAAATGTAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135940713 Original CRISPR AGCCAAACCCCTAGTTTGTT GGG (reversed) Intergenic
No off target data available for this crispr