ID: 1135940816

View in Genome Browser
Species Human (GRCh38)
Location 16:26820117-26820139
Sequence CTCCTTTTACAGATGGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135940816_1135940821 6 Left 1135940816 16:26820117-26820139 CCTTTCCCCATCTGTAAAAGGAG No data
Right 1135940821 16:26820146-26820168 AGCTGGAAGAATTTCTAAAATGG No data
1135940816_1135940822 14 Left 1135940816 16:26820117-26820139 CCTTTCCCCATCTGTAAAAGGAG No data
Right 1135940822 16:26820154-26820176 GAATTTCTAAAATGGTATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135940816 Original CRISPR CTCCTTTTACAGATGGGGAA AGG (reversed) Intergenic
No off target data available for this crispr