ID: 1135941000

View in Genome Browser
Species Human (GRCh38)
Location 16:26821876-26821898
Sequence CTGAGTAATGCTGATGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135940998_1135941000 29 Left 1135940998 16:26821824-26821846 CCGAGAGTTTCAGTAGATCTAAT No data
Right 1135941000 16:26821876-26821898 CTGAGTAATGCTGATGCTGCTGG No data
1135940997_1135941000 30 Left 1135940997 16:26821823-26821845 CCCGAGAGTTTCAGTAGATCTAA No data
Right 1135941000 16:26821876-26821898 CTGAGTAATGCTGATGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135941000 Original CRISPR CTGAGTAATGCTGATGCTGC TGG Intergenic
No off target data available for this crispr