ID: 1135943259

View in Genome Browser
Species Human (GRCh38)
Location 16:26841206-26841228
Sequence CCCAACAAATGTTTTGGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135943249_1135943259 -6 Left 1135943249 16:26841189-26841211 CCCCCACCCAGCTGTACCCCAAC No data
Right 1135943259 16:26841206-26841228 CCCAACAAATGTTTTGGAAAGGG No data
1135943251_1135943259 -8 Left 1135943251 16:26841191-26841213 CCCACCCAGCTGTACCCCAACAA No data
Right 1135943259 16:26841206-26841228 CCCAACAAATGTTTTGGAAAGGG No data
1135943248_1135943259 16 Left 1135943248 16:26841167-26841189 CCAACATGTAAATAAATGATCTC No data
Right 1135943259 16:26841206-26841228 CCCAACAAATGTTTTGGAAAGGG No data
1135943252_1135943259 -9 Left 1135943252 16:26841192-26841214 CCACCCAGCTGTACCCCAACAAA No data
Right 1135943259 16:26841206-26841228 CCCAACAAATGTTTTGGAAAGGG No data
1135943246_1135943259 23 Left 1135943246 16:26841160-26841182 CCCTATACCAACATGTAAATAAA No data
Right 1135943259 16:26841206-26841228 CCCAACAAATGTTTTGGAAAGGG No data
1135943250_1135943259 -7 Left 1135943250 16:26841190-26841212 CCCCACCCAGCTGTACCCCAACA No data
Right 1135943259 16:26841206-26841228 CCCAACAAATGTTTTGGAAAGGG No data
1135943247_1135943259 22 Left 1135943247 16:26841161-26841183 CCTATACCAACATGTAAATAAAT No data
Right 1135943259 16:26841206-26841228 CCCAACAAATGTTTTGGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135943259 Original CRISPR CCCAACAAATGTTTTGGAAA GGG Intergenic