ID: 1135943795

View in Genome Browser
Species Human (GRCh38)
Location 16:26845998-26846020
Sequence ACGGTGTCCCAGAAAGATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135943795_1135943803 19 Left 1135943795 16:26845998-26846020 CCCTGATCTTTCTGGGACACCGT No data
Right 1135943803 16:26846040-26846062 CACTGGAGCTGGGTGTGCTGTGG No data
1135943795_1135943802 9 Left 1135943795 16:26845998-26846020 CCCTGATCTTTCTGGGACACCGT No data
Right 1135943802 16:26846030-26846052 CGAGGAAGATCACTGGAGCTGGG No data
1135943795_1135943797 -9 Left 1135943795 16:26845998-26846020 CCCTGATCTTTCTGGGACACCGT No data
Right 1135943797 16:26846012-26846034 GGACACCGTGAGTCTCTCCGAGG No data
1135943795_1135943799 2 Left 1135943795 16:26845998-26846020 CCCTGATCTTTCTGGGACACCGT No data
Right 1135943799 16:26846023-26846045 GTCTCTCCGAGGAAGATCACTGG No data
1135943795_1135943801 8 Left 1135943795 16:26845998-26846020 CCCTGATCTTTCTGGGACACCGT No data
Right 1135943801 16:26846029-26846051 CCGAGGAAGATCACTGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135943795 Original CRISPR ACGGTGTCCCAGAAAGATCA GGG (reversed) Intergenic
No off target data available for this crispr