ID: 1135945415

View in Genome Browser
Species Human (GRCh38)
Location 16:26860625-26860647
Sequence GTGGTCAACAGGAATGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135945407_1135945415 10 Left 1135945407 16:26860592-26860614 CCACAGGCATTAGGTAGAGGTGA No data
Right 1135945415 16:26860625-26860647 GTGGTCAACAGGAATGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135945415 Original CRISPR GTGGTCAACAGGAATGAGGG AGG Intergenic
No off target data available for this crispr