ID: 1135947713

View in Genome Browser
Species Human (GRCh38)
Location 16:26879478-26879500
Sequence ACTCACTTTCTGTCATTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135947713_1135947716 29 Left 1135947713 16:26879478-26879500 CCAATAAATGACAGAAAGTGAGT No data
Right 1135947716 16:26879530-26879552 AGAAGAGTAGATAATCTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135947713 Original CRISPR ACTCACTTTCTGTCATTTAT TGG (reversed) Intergenic
No off target data available for this crispr