ID: 1135949351

View in Genome Browser
Species Human (GRCh38)
Location 16:26898738-26898760
Sequence AGCCTGCTGGGTGATGGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135949351_1135949357 3 Left 1135949351 16:26898738-26898760 CCAACACCATCACCCAGCAGGCT No data
Right 1135949357 16:26898764-26898786 GTACCCTTGAATTCTTTCCTGGG No data
1135949351_1135949361 25 Left 1135949351 16:26898738-26898760 CCAACACCATCACCCAGCAGGCT No data
Right 1135949361 16:26898786-26898808 GTGTAGCCAAGAGCCCTCCCAGG No data
1135949351_1135949356 2 Left 1135949351 16:26898738-26898760 CCAACACCATCACCCAGCAGGCT No data
Right 1135949356 16:26898763-26898785 AGTACCCTTGAATTCTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135949351 Original CRISPR AGCCTGCTGGGTGATGGTGT TGG (reversed) Intergenic
No off target data available for this crispr