ID: 1135949356

View in Genome Browser
Species Human (GRCh38)
Location 16:26898763-26898785
Sequence AGTACCCTTGAATTCTTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135949344_1135949356 20 Left 1135949344 16:26898720-26898742 CCTAATGTCCTCCCTTCCCCAAC No data
Right 1135949356 16:26898763-26898785 AGTACCCTTGAATTCTTTCCTGG No data
1135949353_1135949356 -10 Left 1135949353 16:26898750-26898772 CCCAGCAGGCTCCAGTACCCTTG No data
Right 1135949356 16:26898763-26898785 AGTACCCTTGAATTCTTTCCTGG No data
1135949352_1135949356 -4 Left 1135949352 16:26898744-26898766 CCATCACCCAGCAGGCTCCAGTA No data
Right 1135949356 16:26898763-26898785 AGTACCCTTGAATTCTTTCCTGG No data
1135949351_1135949356 2 Left 1135949351 16:26898738-26898760 CCAACACCATCACCCAGCAGGCT No data
Right 1135949356 16:26898763-26898785 AGTACCCTTGAATTCTTTCCTGG No data
1135949347_1135949356 8 Left 1135949347 16:26898732-26898754 CCTTCCCCAACACCATCACCCAG No data
Right 1135949356 16:26898763-26898785 AGTACCCTTGAATTCTTTCCTGG No data
1135949345_1135949356 12 Left 1135949345 16:26898728-26898750 CCTCCCTTCCCCAACACCATCAC No data
Right 1135949356 16:26898763-26898785 AGTACCCTTGAATTCTTTCCTGG No data
1135949346_1135949356 9 Left 1135949346 16:26898731-26898753 CCCTTCCCCAACACCATCACCCA No data
Right 1135949356 16:26898763-26898785 AGTACCCTTGAATTCTTTCCTGG No data
1135949348_1135949356 4 Left 1135949348 16:26898736-26898758 CCCCAACACCATCACCCAGCAGG No data
Right 1135949356 16:26898763-26898785 AGTACCCTTGAATTCTTTCCTGG No data
1135949350_1135949356 3 Left 1135949350 16:26898737-26898759 CCCAACACCATCACCCAGCAGGC No data
Right 1135949356 16:26898763-26898785 AGTACCCTTGAATTCTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135949356 Original CRISPR AGTACCCTTGAATTCTTTCC TGG Intergenic
No off target data available for this crispr