ID: 1135949361

View in Genome Browser
Species Human (GRCh38)
Location 16:26898786-26898808
Sequence GTGTAGCCAAGAGCCCTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135949351_1135949361 25 Left 1135949351 16:26898738-26898760 CCAACACCATCACCCAGCAGGCT No data
Right 1135949361 16:26898786-26898808 GTGTAGCCAAGAGCCCTCCCAGG No data
1135949354_1135949361 12 Left 1135949354 16:26898751-26898773 CCAGCAGGCTCCAGTACCCTTGA No data
Right 1135949361 16:26898786-26898808 GTGTAGCCAAGAGCCCTCCCAGG No data
1135949355_1135949361 2 Left 1135949355 16:26898761-26898783 CCAGTACCCTTGAATTCTTTCCT No data
Right 1135949361 16:26898786-26898808 GTGTAGCCAAGAGCCCTCCCAGG No data
1135949359_1135949361 -5 Left 1135949359 16:26898768-26898790 CCTTGAATTCTTTCCTGGGTGTA No data
Right 1135949361 16:26898786-26898808 GTGTAGCCAAGAGCCCTCCCAGG No data
1135949350_1135949361 26 Left 1135949350 16:26898737-26898759 CCCAACACCATCACCCAGCAGGC No data
Right 1135949361 16:26898786-26898808 GTGTAGCCAAGAGCCCTCCCAGG No data
1135949352_1135949361 19 Left 1135949352 16:26898744-26898766 CCATCACCCAGCAGGCTCCAGTA No data
Right 1135949361 16:26898786-26898808 GTGTAGCCAAGAGCCCTCCCAGG No data
1135949348_1135949361 27 Left 1135949348 16:26898736-26898758 CCCCAACACCATCACCCAGCAGG No data
Right 1135949361 16:26898786-26898808 GTGTAGCCAAGAGCCCTCCCAGG No data
1135949353_1135949361 13 Left 1135949353 16:26898750-26898772 CCCAGCAGGCTCCAGTACCCTTG No data
Right 1135949361 16:26898786-26898808 GTGTAGCCAAGAGCCCTCCCAGG No data
1135949358_1135949361 -4 Left 1135949358 16:26898767-26898789 CCCTTGAATTCTTTCCTGGGTGT No data
Right 1135949361 16:26898786-26898808 GTGTAGCCAAGAGCCCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135949361 Original CRISPR GTGTAGCCAAGAGCCCTCCC AGG Intergenic
No off target data available for this crispr