ID: 1135952060 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:26923852-26923874 |
| Sequence | CTTGAAGCTCAGACAGAAAT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1135952054_1135952060 | 27 | Left | 1135952054 | 16:26923802-26923824 | CCACTAGCCACATTTCAAGTACT | No data | ||
| Right | 1135952060 | 16:26923852-26923874 | CTTGAAGCTCAGACAGAAATAGG | No data | ||||
| 1135952057_1135952060 | 20 | Left | 1135952057 | 16:26923809-26923831 | CCACATTTCAAGTACTCAAGGGA | No data | ||
| Right | 1135952060 | 16:26923852-26923874 | CTTGAAGCTCAGACAGAAATAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1135952060 | Original CRISPR | CTTGAAGCTCAGACAGAAAT AGG | Intergenic | ||
| No off target data available for this crispr | |||||