ID: 1135952060

View in Genome Browser
Species Human (GRCh38)
Location 16:26923852-26923874
Sequence CTTGAAGCTCAGACAGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135952054_1135952060 27 Left 1135952054 16:26923802-26923824 CCACTAGCCACATTTCAAGTACT No data
Right 1135952060 16:26923852-26923874 CTTGAAGCTCAGACAGAAATAGG No data
1135952057_1135952060 20 Left 1135952057 16:26923809-26923831 CCACATTTCAAGTACTCAAGGGA No data
Right 1135952060 16:26923852-26923874 CTTGAAGCTCAGACAGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135952060 Original CRISPR CTTGAAGCTCAGACAGAAAT AGG Intergenic
No off target data available for this crispr