ID: 1135956271

View in Genome Browser
Species Human (GRCh38)
Location 16:26958959-26958981
Sequence CTGACCACACAGATGAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135956271_1135956276 19 Left 1135956271 16:26958959-26958981 CCTGGCTTCATCTGTGTGGTCAG No data
Right 1135956276 16:26959001-26959023 CTCCAGTGTAGAAGGAGCACAGG No data
1135956271_1135956275 11 Left 1135956271 16:26958959-26958981 CCTGGCTTCATCTGTGTGGTCAG No data
Right 1135956275 16:26958993-26959015 CTCTGTCTCTCCAGTGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135956271 Original CRISPR CTGACCACACAGATGAAGCC AGG (reversed) Intergenic
No off target data available for this crispr